Clone FMO01410 Report

Search the DGRC for FMO01410

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:14
Well:10
Vector:pMK33-CFH-BD
Associated Gene/Transcriptolf186-F-RC
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01410.5prime Sequence

422 bp (422 high quality bases) assembled on 2008-03-18

> FMO01410.5prime
CAGTCGACATGTCTGTGTGGACCACGGCCAACAATTCGGGCCTAGAGACG
CCAACAAAGTCGCCGATCACGTCGTCGGTTCCGCGGGCAGCGAGAAGTTC
TGCAGTGATCACCACTGGAAATCACCAGCAGCACCACTTCCAGCACGTTG
TGGCCGCCGCCGTTGCAGCCGCCACTTCAGTGGCCACCGGTCATCAGTTC
CAGCAACAGTTCCCGCTGCACGCACATCCGCATCCACAGCACCACAGCAA
CAGTCCCACGGGTAGCGGCAGCAACAGCAACAACAGCGCAGGTTTCCAGC
GCACCAGCATCAGCAACTCGCTGCTGCAGTTCCCGCCGCCCCCGCCCCCT
TCCTCACAGAACCAGGCGAAGGCAGGCCGCACCGTTCAAATTGATTGTCG
AATTGCAAGCTTTCTAGACCAT

FMO01410.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:17:30
Subject Length Description Subject Range Query Range Score Percent Strand
olf186-F-RG 4582 CG11430-RG 236..632 8..404 1985 100 Plus
olf186-F-RF 2407 CG11430-RF 563..926 8..371 1820 100 Plus
olf186-F-RA 2080 CG11430-RA 236..599 8..371 1820 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:17:27
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 17851097..17851461 8..372 1825 100 Plus
Blast to na_te.dros performed 2014-11-28 20:17:28
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6730..6958 119..350 253 60.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6724..6952 87..313 247 59.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6734..6887 166..317 205 63.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6737..6862 192..319 203 65.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6713..6838 204..329 199 66.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2314..2505 121..317 189 58.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6718..6819 224..328 183 71.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2310..2427 192..317 179 65.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2310..2417 213..329 176 67.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2307..2424 201..317 164 61 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2747..2857 203..318 162 65 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2331..2460 192..317 154 62.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2307..2382 242..317 145 70.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6735..6788 264..317 143 80.4 Plus
roo 9092 roo DM_ROO 9092bp 1059..1155 193..288 140 61.9 Plus
roo 9092 roo DM_ROO 9092bp 1052..1148 226..317 137 67 Plus
roo 9092 roo DM_ROO 9092bp 1054..1154 213..317 137 64.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2588..2643 262..317 118 67.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2437..2668 86..318 117 55.4 Plus
roo 9092 roo DM_ROO 9092bp 1062..1115 264..317 116 75 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1518..1575 231..287 107 67.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2766..2835 245..317 106 64.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2593..2649 261..317 105 64.9 Plus

FMO01410.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:47:59 Download gff for FMO01410.5prime
Subject Subject Range Query Range Percent Splice Strand
CG11430-RC 219..619 8..408 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:34:24 Download gff for FMO01410.5prime
Subject Subject Range Query Range Percent Splice Strand
olf186-F-RG 236..636 8..408 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:55:42 Download gff for FMO01410.5prime
Subject Subject Range Query Range Percent Splice Strand
olf186-F-RG 236..636 8..408 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:55:42 Download gff for FMO01410.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 17851097..17851460 8..371 100 -> Plus
2R 17855140..17855176 372..408 94   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:34:24 Download gff for FMO01410.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 13738602..13738965 8..371 100 -> Plus
arm_2R 13742645..13742681 372..408 94   Plus