Clone FMO02964 Report

Search the DGRC for FMO02964

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:29
Well:64
Vector:pMK33-CFH-BD
Associated Gene/Transcript
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO02964.5prime Sequence

295 bp (295 high quality bases) assembled on 2008-07-02

> FMO02964.5prime
CGTATAGCATACATAATACGAAGTTATCAGTCGACATGCCCAATTCGTAC
CAGAGTCCGCAGCTGAACAAGCAGGGCAATAGCAATAGCACCACCACCAG
CAGTACCTCAGTAAGGAGCACCACAGTGGTGCAACAGCAACATCACCAGC
AACAACATCAGCAAATCAAGCCAAGTATTGTGGAAACCCCGGCGACACCA
CAGCCACAAGTTCCGCCCGAAGACGAGATACCCCACAACATAGTGTTCAA
CAATGTGAGCGCCTTTACATCGATGAGCAGGCGAAATCACGAGGA

FMO02964.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:25:06
Subject Length Description Subject Range Query Range Score Percent Strand
CG34417-RU 17577 CG34417-RU 14664..14925 34..295 1310 100 Plus
CG34417-RT 16863 CG34417-RT 14664..14925 34..295 1310 100 Plus
CG34417-RR 16701 CG34417-RR 14664..14925 34..295 1310 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:25:03
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 6582507..6582768 34..295 1310 100 Plus
Blast to na_te.dros performed 2014-11-28 22:25:04
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6720..6897 67..240 212 62.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6730..6895 49..209 202 64.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2310..2416 57..163 201 68.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6797..6970 57..230 185 63.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2296..2429 28..164 181 64 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6799..6916 47..164 175 64.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2302..2410 52..163 174 64.3 Plus
roo 9092 roo DM_ROO 9092bp 1036..1183 36..181 168 64.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6718..6844 85..209 161 62.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2370..2478 57..162 158 64.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2688..2827 11..163 149 61.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2884..2981 66..164 141 64.4 Plus
roo 9092 roo DM_ROO 9092bp 1030..1135 67..164 140 66 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6731..6808 132..209 137 67.1 Plus
roo 9092 roo DM_ROO 9092bp 1059..1137 133..208 135 67.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2311..2408 114..209 133 65 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6723..6775 114..164 133 77.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2622..2663 132..169 119 83.3 Plus
gypsy11 4428 gypsy11 GYPSY11 4428bp 980..1022 131..173 116 74.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1527..1558 132..163 115 84.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1541..1593 131..177 115 77.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2319..2350 132..163 115 84.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2597..2637 131..171 115 75.6 Plus
TART-C 11124 TART-C TARTC 11124bp 9175..9216 122..163 111 73.8 Plus

FMO02964.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-07-02 17:01:16 Download gff for FMO02964.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34417-RH 14644..14913 23..294 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:02:06 Download gff for FMO02964.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34417-RR 14655..14924 23..294 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:13:56 Download gff for FMO02964.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34417-RR 14655..14924 23..294 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 23:13:56 Download gff for FMO02964.5prime
Subject Subject Range Query Range Percent Splice Strand
X 6582498..6582767 23..294 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:02:06 Download gff for FMO02964.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 6476531..6476800 23..294 98   Plus