Clone FMO03122 Report

Search the DGRC for FMO03122

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:31
Well:22
Vector:pMK33-CFH-BD
Associated Gene/Transcriptaret-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO03122.5prime Sequence

416 bp (196 high quality bases) assembled on 2008-07-07

> FMO03122.5prime
GCTTCTTTTTTGGCCAATCGCCGCATGATTTTCGATTTCTCCGAGAAGAA
CTACGATATCTACTTGGATGCTTTTGGTATGAGTGATAAGAGCAGCAGTG
CAACGAACCGCCTGCCGAATAGTCCCATACACAGCAACAACAATAATCCA
TCGCTGCTGAACAACAACAACAATAACAGCAACGGCACCTGCAGCAACAA
CAGCTTAAACGTTGGCAACAACAACAGCATTCCGAGCTTGGGCGGCAGCA
ACAGCAACGCACTGGTTTCCGTTGGCAGCAACGGTATAATGTCCGCCGCC
GGTTTGGTCAACAACAATAACAATCCGTGCAACGCCAACCGCAATGTGGT
CGCCATGGTCGACGATGACGCCTGCTTCCGTCTGGATACGGACGCCACGG
TGACGTACGGCGAGAA

FMO03122.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:51:37
Subject Length Description Subject Range Query Range Score Percent Strand
aret-RF 3342 CG31762-RF 349..764 1..416 1975 98.3 Plus
aret-RE 2302 CG31762-RE 349..764 1..416 1975 98.3 Plus
aret-RA 2651 CG31762-RA 349..764 1..416 1975 98.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:51:34
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 12271591..12271938 69..416 1665 98.6 Plus
2L 23513712 2L 12271280..12271347 1..68 310 97.1 Plus
Blast to na_te.dros performed 2014-11-28 18:51:35
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2342..2522 86..260 234 64.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6729..6827 160..258 225 69.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2333..2540 131..338 221 60.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6725..6848 132..258 213 66.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6732..6864 118..256 212 65.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6738..6899 91..258 212 62.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6780..7036 91..344 198 57.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6705..6812 151..258 180 63 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2307..2394 171..258 179 67 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2415..2628 132..339 171 57.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6720..6794 187..258 152 69.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1518..1596 132..209 149 70.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2463..2529 132..204 144 73 Plus
roo 9092 roo DM_ROO 9092bp 1081..1154 131..204 144 69.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2305..2452 184..343 141 59.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1496..1584 174..258 130 62.9 Plus
roo 9092 roo DM_ROO 9092bp 1059..1142 178..258 125 63.1 Plus
BS 5142 BS BS 5142bp 1976..2103 93..229 123 60.1 Plus

FMO03122.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-07-09 14:59:54 Download gff for FMO03122.5prime
Subject Subject Range Query Range Percent Splice Strand
aret-RC 345..758 1..414 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:23:52 Download gff for FMO03122.5prime
Subject Subject Range Query Range Percent Splice Strand
aret-RA 349..764 1..416 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:39:12 Download gff for FMO03122.5prime
Subject Subject Range Query Range Percent Splice Strand
aret-RA 349..764 1..416 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:39:12 Download gff for FMO03122.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 12271280..12271347 1..68 97 -> Plus
2L 12271591..12271938 69..416 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:23:52 Download gff for FMO03122.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 12271280..12271347 1..68 97 -> Plus
arm_2L 12271591..12271938 69..416 98   Plus