FMO03122.5prime Sequence
416 bp (196 high quality bases) assembled on 2008-07-07
> FMO03122.5prime
GCTTCTTTTTTGGCCAATCGCCGCATGATTTTCGATTTCTCCGAGAAGAA
CTACGATATCTACTTGGATGCTTTTGGTATGAGTGATAAGAGCAGCAGTG
CAACGAACCGCCTGCCGAATAGTCCCATACACAGCAACAACAATAATCCA
TCGCTGCTGAACAACAACAACAATAACAGCAACGGCACCTGCAGCAACAA
CAGCTTAAACGTTGGCAACAACAACAGCATTCCGAGCTTGGGCGGCAGCA
ACAGCAACGCACTGGTTTCCGTTGGCAGCAACGGTATAATGTCCGCCGCC
GGTTTGGTCAACAACAATAACAATCCGTGCAACGCCAACCGCAATGTGGT
CGCCATGGTCGACGATGACGCCTGCTTCCGTCTGGATACGGACGCCACGG
TGACGTACGGCGAGAA
FMO03122.5prime Blast Records
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:51:37
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
aret-RF | 3342 | CG31762-RF | 349..764 | 1..416 | 1975 | 98.3 | Plus |
aret-RE | 2302 | CG31762-RE | 349..764 | 1..416 | 1975 | 98.3 | Plus |
aret-RA | 2651 | CG31762-RA | 349..764 | 1..416 | 1975 | 98.3 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:51:34
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2L | 23513712 | 2L | 12271591..12271938 | 69..416 | 1665 | 98.6 | Plus |
2L | 23513712 | 2L | 12271280..12271347 | 1..68 | 310 | 97.1 | Plus |
Blast to na_te.dros performed 2014-11-28 18:51:35
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2342..2522 | 86..260 | 234 | 64.5 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6729..6827 | 160..258 | 225 | 69.7 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2333..2540 | 131..338 | 221 | 60.9 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6725..6848 | 132..258 | 213 | 66.4 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6732..6864 | 118..256 | 212 | 65.7 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6738..6899 | 91..258 | 212 | 62.7 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6780..7036 | 91..344 | 198 | 57.6 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6705..6812 | 151..258 | 180 | 63 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2307..2394 | 171..258 | 179 | 67 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2415..2628 | 132..339 | 171 | 57.9 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6720..6794 | 187..258 | 152 | 69.3 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 1518..1596 | 132..209 | 149 | 70.4 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2463..2529 | 132..204 | 144 | 73 | Plus |
roo | 9092 | roo DM_ROO 9092bp | 1081..1154 | 131..204 | 144 | 69.3 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2305..2452 | 184..343 | 141 | 59.4 | Plus |
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 1496..1584 | 174..258 | 130 | 62.9 | Plus |
roo | 9092 | roo DM_ROO 9092bp | 1059..1142 | 178..258 | 125 | 63.1 | Plus |
BS | 5142 | BS BS 5142bp | 1976..2103 | 93..229 | 123 | 60.1 | Plus |
FMO03122.5prime Sim4 Records
Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-07-09 14:59:54 Download gff for
FMO03122.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
aret-RC | 345..758 | 1..414 | 98 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:23:52 Download gff for
FMO03122.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
aret-RA | 349..764 | 1..416 | 98 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:39:12 Download gff for
FMO03122.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
aret-RA | 349..764 | 1..416 | 98 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:39:12 Download gff for
FMO03122.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2L | 12271280..12271347 | 1..68 | 97 | -> | Plus |
2L | 12271591..12271938 | 69..416 | 98 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:23:52 Download gff for
FMO03122.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_2L | 12271280..12271347 | 1..68 | 97 | -> | Plus |
arm_2L | 12271591..12271938 | 69..416 | 98 | | Plus |