Clone FMO04601 Report

Search the DGRC for FMO04601

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:46
Well:1
Vector:pMK33-CFH-BD
Associated Gene/TranscriptGgamma30A-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO04601.5prime Sequence

271 bp (271 high quality bases) assembled on 2008-08-08

> FMO04601.5prime
TTCGTATAGCATACATTATACGAAGTTATCAGTCGACATGGATCCCAGTG
CTCTACAAAACATGGATCGGGACGCATTAAAGAAGCAAATCGAGAATATG
AAATATCAGGCCTCCATGGAGCGCTGGCCGTTATCTAAATCCATAGCAGA
AATGCGCTCGTTCATCGAGGAGAACGAGAAAAATGATCCGTTGATCAATG
CGCCGGATAAGAAGAACAATCCATGGGCCGAAAAGGGCAAATGCGTTATT
ATGGCAAGCTTTCTAGACCAT

FMO04601.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:02:10
Subject Length Description Subject Range Query Range Score Percent Strand
Ggamma30A-RJ 2995 CG3694-RJ 673..889 37..253 1085 100 Plus
Ggamma30A-RH 4742 CG3694-RH 163..379 37..253 1085 100 Plus
Ggamma30A-RG 1470 CG3694-RG 614..830 37..253 1085 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:02:07
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 9272494..9272607 37..150 570 100 Plus
2L 23513712 2L 9291056..9291158 151..253 515 100 Plus
Blast to na_te.dros performed 2014-11-28 20:02:08
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\Tv1 6868 Dvir\Tv1 6868bp Derived from AF056940 (Rel. 62, Last updated, Version 4). 1173..1235 135..199 104 64.6 Plus

FMO04601.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:37:46 Download gff for FMO04601.5prime
Subject Subject Range Query Range Percent Splice Strand
Ggamma30A-RG 601..837 23..261 96   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2010-07-30 09:23:51 Download gff for FMO04601.5prime
Subject Subject Range Query Range Percent Splice Strand
Ggamma30A-RB 152..388 23..261 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:52:21 Download gff for FMO04601.5prime
Subject Subject Range Query Range Percent Splice Strand
Ggamma30A-RG 601..837 23..261 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:52:21 Download gff for FMO04601.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 9272475..9272607 17..150 92 -> Plus
2L 9291056..9291165 151..261 96   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:37:46 Download gff for FMO04601.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 9272475..9272607 17..150 92 -> Plus
arm_2L 9291056..9291165 151..261 96   Plus