Clone FMO04681 Report

Search the DGRC for FMO04681

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:46
Well:81
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG31517-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO04681.5prime Sequence

246 bp (246 high quality bases) assembled on 2008-08-08

> FMO04681.5prime
ACTTCGTATAGCATACATTATACGAAGTTATCAGTCGACATGTCGTGGCG
ACGGTACGTGCGGCCAAACAAATTACAGGGAAATTGCGTCACCTGCAGGA
ATTTCCACTCGACATTGTCAAATGCCATCAGAAATCGCTGGACATGTTGT
AACATTAATTTGACATTTTACGGCCCAGGACGGGGATCGTCGACGGGAAT
GAGACCGCAGAGCAACGCAGGACAACGTGCAAGCTTTCTAGACCAT

FMO04681.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:56:55
Subject Length Description Subject Range Query Range Score Percent Strand
CG31517-RB 1185 CG31517-RB 415..604 39..228 950 100 Plus
CG31517-RA 827 CG31517-RA 415..604 39..228 950 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:56:53
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 13948834..13948998 39..203 825 100 Plus
Blast to na_te.dros performed on 2014-11-28 22:56:54 has no hits.

FMO04681.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:10:13 Download gff for FMO04681.5prime
Subject Subject Range Query Range Percent Splice Strand
CG31517-RA 400..592 39..232 98   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-08-08 10:10:24 Download gff for FMO04681.5prime
Subject Subject Range Query Range Percent Splice Strand
CG31517-RA 400..592 39..232 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:45:08 Download gff for FMO04681.5prime
Subject Subject Range Query Range Percent Splice Strand
CG31517-RA 415..607 39..232 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 23:45:08 Download gff for FMO04681.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 13948834..13948998 39..203 100 -> Plus
3R 13949083..13949110 204..232 93   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:10:13 Download gff for FMO04681.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 9774556..9774720 39..203 100 -> Plus
arm_3R 9774805..9774832 204..232 93   Plus