Clone FMO05246 Report

Search the DGRC for FMO05246

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:52
Well:46
Vector:pMK33-CFH-BD
Associated Gene/TranscriptAcyp2-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO05246.5prime Sequence

360 bp (360 high quality bases) assembled on 2008-08-22

> FMO05246.5prime
TCGTATAGCATACATTATACGAAGTTATCAGTCGACATGGCGGGATCTGG
AGTTGCCAAGCAGATATTTGCCCTCGATTTCGAGATCTTTGGACGAGTGC
AAGGTGTGTTCTTCCGCAAACACACGTCGCATGAGGCTAAAAGATTGGGA
GTTAGGGGCTGGTGCATGAATACCCGGGATGGGACCGTCAAGGGACAACT
GGAGGCTCCTATGATGAATTTAATGGAAATGAAACATTGGCTGGAGAACA
ACCGAATTCCCAACGCTAAGGTCTCAAAGGCTGAATTTTCGCAAATCCAG
GAAATCGAGGACTATACGTTCACTTCCTTTGACATAAAACATGCAAGCTT
TCTAGACCAT

FMO05246.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:24:31
Subject Length Description Subject Range Query Range Score Percent Strand
Acyp2-RB 619 CG18505-RB 148..453 37..342 1530 100 Plus
Acyp2-RA 543 CG18505-RA 148..453 37..342 1530 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:24:29
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 15793210..15793321 231..342 560 100 Plus
3R 32079331 3R 15793042..15793152 121..231 555 100 Plus
3R 32079331 3R 15792835..15792903 37..105 345 100 Plus
Blast to na_te.dros performed on 2014-11-28 20:24:30 has no hits.

FMO05246.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:45:49 Download gff for FMO05246.5prime
Subject Subject Range Query Range Percent Splice Strand
Acyp2-RA 144..456 29..346 98   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-08-22 17:14:03 Download gff for FMO05246.5prime
Subject Subject Range Query Range Percent Splice Strand
Acyp2-RA 93..405 29..346 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:05:13 Download gff for FMO05246.5prime
Subject Subject Range Query Range Percent Splice Strand
Acyp2-RA 144..456 29..346 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 21:05:13 Download gff for FMO05246.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 15792831..15792901 29..103 94 -> Plus
3R 15792957..15792973 104..120 100 -> Plus
3R 15793042..15793151 121..230 100 -> Plus
3R 15793210..15793324 231..346 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:45:49 Download gff for FMO05246.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 11618553..11618623 29..103 94 -> Plus
arm_3R 11618679..11618695 104..120 100 -> Plus
arm_3R 11618764..11618873 121..230 100 -> Plus
arm_3R 11618932..11619046 231..346 98   Plus