Clone FMO05259 Report

Search the DGRC for FMO05259

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:52
Well:59
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG15198-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO05259.5prime Sequence

170 bp (17 high quality bases) assembled on 2008-08-22

> FMO05259.5prime
CTGTCAGCCAACTACTACGACCACCAATGGTTCTCCAACGGATGCAATGG
ATCCCAACACTTTGCCCAGCGGAGCTGCGGGCGGCATGGTAATCCTGGCC
AACATATTTAGCACCGTCGAGGTCCTGGCCGCCGCCGCTCGTATGGGTGG
AGCAGCGGGCACTGGAGGGG

FMO05259.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:50:14
Subject Length Description Subject Range Query Range Score Percent Strand
CG15198-RA 650 CG15198-RA 284..453 1..170 775 97.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:50:12
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 11248519..11248688 1..170 775 97.1 Plus
Blast to na_te.dros performed on 2014-11-28 22:50:13 has no hits.

FMO05259.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:05:22 Download gff for FMO05259.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15198-RA 284..453 1..170 97   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-08-22 17:14:19 Download gff for FMO05259.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15198-RA 111..280 1..170 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:27:25 Download gff for FMO05259.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15198-RA 284..453 1..170 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 23:27:25 Download gff for FMO05259.5prime
Subject Subject Range Query Range Percent Splice Strand
X 11248519..11248688 1..170 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:05:22 Download gff for FMO05259.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 11142552..11142721 1..170 97   Plus