Clone FMO05364 Report

Search the DGRC for FMO05364

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:53
Well:64
Vector:pMK33-CFH-BD
Associated Gene/Transcript
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO05364.5prime Sequence

227 bp (227 high quality bases) assembled on 2008-08-22

> FMO05364.5prime
CGTATAGCATACATTATACGAAGTTATCAGTCGACATGAGTGCGACCAGG
GGAAAGGAGGCAAAGAAAAGAAAACCAACCCCCACCAGCGACGGCGGAGA
ACAGGAAAACAACAACAGAAGGCACACAACCAGCGCACCACCACCATCAT
TACCATTACCGCCACCACCCACCACAACACTTCGTCATCGTTTCGCGTTG
TGCAGAAAAGCAAGCTTTCTAGACCAT

FMO05364.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:36:14
Subject Length Description Subject Range Query Range Score Percent Strand
l(3)neo38-RL 2247 CG6930-RL 341..514 36..209 855 99.4 Plus
l(3)neo38-RD 4963 CG6930-RD 881..1054 36..209 855 99.4 Plus
l(3)neo38-RC 2247 CG6930-RC 341..514 36..209 855 99.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:36:12
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 11777839..11778012 209..36 855 99.4 Minus
Blast to na_te.dros performed on 2014-11-28 20:36:13 has no hits.

FMO05364.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:31:49 Download gff for FMO05364.5prime
Subject Subject Range Query Range Percent Splice Strand
l(3)neo38-RC 336..519 29..217 95   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-08-22 17:20:44 Download gff for FMO05364.5prime
Subject Subject Range Query Range Percent Splice Strand
l(3)neo38-RB 728..911 29..217 95   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:22:41 Download gff for FMO05364.5prime
Subject Subject Range Query Range Percent Splice Strand
l(3)neo38-RC 336..519 29..217 95   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 21:22:41 Download gff for FMO05364.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 11777834..11778017 29..217 95   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:31:49 Download gff for FMO05364.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 7603556..7603739 29..217 95   Minus