Clone FMO05401 Report

Search the DGRC for FMO05401

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:54
Well:1
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRpb10-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO05401.5prime Sequence

227 bp (227 high quality bases) assembled on 2008-08-25

> FMO05401.5prime
CAGTCGACATGATTATTCCAATCCGTTGTTTCACCTGCGGCAAGGTCATT
GGCAACAAGTGGGAGTCGTATTTGGGTCTCCTGCAAGCGGAATACACCGA
AGGAGATGCCCTGGATGCTTTGGGTCTAAAGAGGTACTGCTGCCGTCGCA
TGCTCCTGGGCCACGTGGATCTTATCGAAAAACTGCTCAACTATGCTCCT
CTGGAGAAGGCAAGCTTTCTAGACCAT

FMO05401.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:47:13
Subject Length Description Subject Range Query Range Score Percent Strand
Rpb10-RA 405 CG13628-RA 108..308 9..209 1005 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:47:11
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 24717795..24717901 103..209 535 100 Plus
3R 32079331 3R 24717618..24717712 9..103 475 100 Plus
Blast to na_te.dros performed on 2014-11-28 20:47:12 has no hits.

FMO05401.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:39:45 Download gff for FMO05401.5prime
Subject Subject Range Query Range Percent Splice Strand
Rpb10-RA 108..312 9..213 99   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-09-02 16:29:40 Download gff for FMO05401.5prime
Subject Subject Range Query Range Percent Splice Strand
Rpb10-RA 65..269 9..213 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:29:04 Download gff for FMO05401.5prime
Subject Subject Range Query Range Percent Splice Strand
Rpb10-RA 108..312 9..213 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 21:29:04 Download gff for FMO05401.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 24717618..24717712 9..103 100 -> Plus
3R 24717796..24717905 104..213 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:39:45 Download gff for FMO05401.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 20543340..20543434 9..103 100 -> Plus
arm_3R 20543518..20543627 104..213 98   Plus