 | BDGP Sequence Production Resources |
| BDGP Sequence Production Resources |
Search the DGRC for FMO06018
| Library: | FMO |
| Tissue Source: | D. melanogaster |
| Created by: | Charles Yu |
| Date Registered: | 2006-03-07 |
| Comments: | BD Creator expression clones with C-terminus FLAG HA tag for tissue culture |
| Original Plate Number: | 60 |
| Well: | 18 |
| Vector: | pMK33-CFH-BD |
| Associated Gene/Transcript | gcl-RA |
| Protein status: | |
| Sequenced Size: | Not sequenced |
73 bp (-60 high quality bases) assembled on 2008-09-15
> FMO06018.5prime CGGAAGCGGAAGCGCAGCATTTGATTCATCTTTGGGGAAGGATGATCCGG CCCAGTTAGACACCACTCAGCCC