Clone FMO06070 Report

Search the DGRC for FMO06070

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:60
Well:70
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG5618-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO06070.5prime Sequence

152 bp (-77 high quality bases) assembled on 2008-09-15

> FMO06070.5prime
TTTATCAGTCGACATGGCTGAATCAGTGGATGGAGCAGAGACTGTTGACC
ATATTCGCGATGGCCTCATGGACGACTGGAAGATCCTGGAGAACGTATTC
CACCTTCCCCGGAAGGAGGATACCTTCTGCGTGGATCCCCAAAAATGGTT
TA

FMO06070.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:57:04
Subject Length Description Subject Range Query Range Score Percent Strand
CG5618-RE 1750 CG5618-RE 307..441 14..148 630 97.8 Plus
CG5618-RD 2230 CG5618-RD 457..591 14..148 630 97.8 Plus
CG5618-RA 1938 CG5618-RA 307..441 14..148 630 97.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 21:57:02
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 20354226..20354360 14..148 630 97.8 Plus
Blast to na_te.dros performed on 2014-11-28 21:57:03 has no hits.

FMO06070.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:39:27 Download gff for FMO06070.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5618-RA 302..441 8..151 93   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-09-15 10:57:47 Download gff for FMO06070.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5618-RA 270..409 8..151 93   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:54:24 Download gff for FMO06070.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5618-RA 302..441 8..151 93   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:54:24 Download gff for FMO06070.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 20354221..20354360 8..151 93   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:39:27 Download gff for FMO06070.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 20347321..20347460 8..151 93   Plus