Clone FMO06071 Report

Search the DGRC for FMO06071

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:60
Well:71
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG18324-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO06071.5prime Sequence

153 bp (98 high quality bases) assembled on 2008-09-15

> FMO06071.5prime
CAGTCGACATGTTCTTTGGTGCTCTGGGCGGCTGCACGGGCACCTATTTC
GCCAGCCCCTTCTACATGATAAAGGCCCAACAGCATGCCCAGGCGGTTCA
GTCCATTGCCGTAGGCTTTCATCACAAGCATATTTCGATGATGTTTGCCC
TGC

FMO06071.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:43:38
Subject Length Description Subject Range Query Range Score Percent Strand
CG18324-RA 1401 CG18324-RA 677..822 8..153 655 96.6 Plus
CG18324-RB 1118 CG18324-RB 394..539 8..153 655 96.6 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:43:36
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 14169569..14169654 68..153 370 95.3 Plus
2R 25286936 2R 14169462..14169522 8..68 290 98.4 Plus
Blast to na_te.dros performed on 2014-11-28 19:43:37 has no hits.

FMO06071.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:43:06 Download gff for FMO06071.5prime
Subject Subject Range Query Range Percent Splice Strand
CG18324-RB 389..539 1..153 94   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-09-15 10:57:48 Download gff for FMO06071.5prime
Subject Subject Range Query Range Percent Splice Strand
CG18324-RA 588..738 1..153 94   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:18:30 Download gff for FMO06071.5prime
Subject Subject Range Query Range Percent Splice Strand
CG18324-RB 389..539 1..153 94   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:18:30 Download gff for FMO06071.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 14169457..14169522 1..68 92 -> Plus
2R 14169570..14169654 69..153 95   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:43:06 Download gff for FMO06071.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 10056962..10057027 1..68 92 -> Plus
arm_2R 10057075..10057159 69..153 95   Plus