Clone FMO06075 Report

Search the DGRC for FMO06075

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:60
Well:75
Vector:pMK33-CFH-BD
Associated Gene/Transcript128up-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO06075.5prime Sequence

213 bp (213 high quality bases) assembled on 2008-09-15

> FMO06075.5prime
CAGTCGACATGAGCACAATATTGGAGAAAATCTCGGCCATCGAGTCGGAG
ATGGCCCGAACCCAAAAGAACAAGGCCACCTCGGCCCATTTGGGTCTACT
GAAGGCGAAGCTGGCTAAGCTGCGACGCGAACTGATTTCCCCCAAAGGAG
GCGGCGGCGGAACCGGCGAAGCTGGCTTCGAGGTGGCCAAGACTGGAGAT
GCCCGGGTGGGAT

FMO06075.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:57:50
Subject Length Description Subject Range Query Range Score Percent Strand
128up-RA 1304 CG8340-RA 125..330 8..213 1030 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 21:57:48
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 12037595..12037717 49..171 615 100 Plus
2R 25286936 2R 12037769..12037812 170..213 220 100 Plus
2R 25286936 2R 12037422..12037464 8..50 215 100 Plus
Blast to na_te.dros performed on 2014-11-28 21:57:49 has no hits.

FMO06075.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:46:14 Download gff for FMO06075.5prime
Subject Subject Range Query Range Percent Splice Strand
128up-RA 117..330 1..213 98   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-09-15 10:58:07 Download gff for FMO06075.5prime
Subject Subject Range Query Range Percent Splice Strand
128up-RA 109..322 1..213 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:46:02 Download gff for FMO06075.5prime
Subject Subject Range Query Range Percent Splice Strand
128up-RA 117..330 1..213 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:46:02 Download gff for FMO06075.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 12037414..12037464 1..50 94 -> Plus
2R 12037597..12037717 51..171 100 -> Plus
2R 12037771..12037812 172..213 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:46:14 Download gff for FMO06075.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 7925276..7925317 172..213 100   Plus
arm_2R 7924919..7924969 1..50 94 -> Plus
arm_2R 7925102..7925222 51..171 100 -> Plus