Clone FMO06094 Report

Search the DGRC for FMO06094

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:60
Well:94
Vector:pMK33-CFH-BD
Associated Gene/Transcriptnopo-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO06094.5prime Sequence

201 bp (201 high quality bases) assembled on 2008-09-15

> FMO06094.5prime
CAGTCGACATGTTGAACTTAAACTGCGTGATATGCGCCGAATTGTTTGGC
CAGGCCGACGAGGTTTTTGCCACAGTTTGTGGTCATATGTTCCACCACAA
CTGTCTAAATCAATGGCTCGATCGATCAAAGACCTGTCCTCATTGCCGGA
ATAAGTGCACTACCCGCAACATATTTAGGGTCTATTTCAATCTGGCCAAC
T

FMO06094.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:02:09
Subject Length Description Subject Range Query Range Score Percent Strand
nopo-RB 1671 CG5140-RB 227..419 9..201 950 99.5 Plus
nopo-RA 1553 CG5140-RA 106..298 9..201 950 99.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:02:08
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 18180722..18180837 9..124 580 100 Plus
2R 25286936 2R 18180896..18180973 124..201 375 98.7 Plus
Blast to na_te.dros performed 2014-11-28 19:02:08
Subject Length Description Subject Range Query Range Score Percent Strand
blood 7410 blood BLOOD 7410bp 1764..1826 138..76 107 67.2 Minus

FMO06094.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:19:43 Download gff for FMO06094.5prime
Subject Subject Range Query Range Percent Splice Strand
nopo-RA 106..298 9..201 99   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-09-15 10:58:14 Download gff for FMO06094.5prime
Subject Subject Range Query Range Percent Splice Strand
nopo-RA 227..419 9..201 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:37:29 Download gff for FMO06094.5prime
Subject Subject Range Query Range Percent Splice Strand
nopo-RA 106..298 9..201 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:37:29 Download gff for FMO06094.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 18180722..18180837 9..124 100 -> Plus
2R 18180897..18180973 125..201 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:19:43 Download gff for FMO06094.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 14068227..14068342 9..124 100 -> Plus
arm_2R 14068402..14068478 125..201 98   Plus