Clone FMO06244 Report

Search the DGRC for FMO06244

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:62
Well:44
Vector:pMK33-CFH-BD
Associated Gene/TranscriptMtnA-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO06244.5prime Sequence

146 bp (146 high quality bases) assembled on 2008-09-15

> FMO06244.5prime
CAGTCGACATGCCTTGCCCATGCGGAAGCGGATGCAAATGCGCCAGCCAG
GCCACCAAGGGATCCTGCAACTGCGGATCTGACTGCAAGTGCGGCGGCGA
CAAGAAATCCGCCTGCGGCTGCTCCGAGGCAAGCTTTCTAGACCAT

FMO06244.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:05:32
Subject Length Description Subject Range Query Range Score Percent Strand
MtnA-RB 700 CG9470-RB 126..245 9..128 600 100 Plus
MtnA-RA 329 CG9470-RA 126..245 9..128 600 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:05:30
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 9783862..9783960 128..30 495 100 Minus
Blast to na_te.dros performed on 2014-11-28 19:05:31 has no hits.

FMO06244.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:43:09 Download gff for FMO06244.5prime
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 118..254 1..138 95   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-09-15 11:05:01 Download gff for FMO06244.5prime
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 119..255 1..138 95   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:59:13 Download gff for FMO06244.5prime
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 118..254 1..138 95   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:59:13 Download gff for FMO06244.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 9783853..9783959 31..138 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:43:09 Download gff for FMO06244.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 5609575..5609681 31..138 97 <- Minus