Clone FMO06247 Report

Search the DGRC for FMO06247

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:62
Well:47
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRpS28b-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO06247.5prime Sequence

221 bp (221 high quality bases) assembled on 2008-09-15

> FMO06247.5prime
CAGTCGACATGGACAAACCAGTTGTGTGGGCACGCGTCATGAAGGTTCTG
GGCCGCACCGGCTCCCAGGGTCAGTGTACCCAGGTGAAGGTCGAGTTCCT
GGGCGAGCAGAACCGCCAGATTATCCGAAACGTGAAGGGACCAGTTCGCG
AGGGCGACATCCTGACCCTTTTGGAATCCGAACGTGAAGCCAGGAGGCTG
CGCGCAAGCTTTCTAGACCAT

FMO06247.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:09:03
Subject Length Description Subject Range Query Range Score Percent Strand
RpS28b-RB 972 CG2998-RB 86..282 7..203 985 100 Plus
RpS28b-RA 520 CG2998-RA 86..282 7..203 985 100 Plus
RpS28a-RA 304 CG15527-RA 93..242 54..203 330 81.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:09:01
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 9554708..9554904 7..203 985 100 Plus
3R 32079331 3R 30022407..30022556 203..54 330 81.3 Minus
Blast to na_te.dros performed on 2014-11-28 19:09:02 has no hits.

FMO06247.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:24:05 Download gff for FMO06247.5prime
Subject Subject Range Query Range Percent Splice Strand
RpS28b-RA 79..287 1..211 96   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-09-15 11:04:50 Download gff for FMO06247.5prime
Subject Subject Range Query Range Percent Splice Strand
RpS28b-RA 83..291 1..211 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:41:12 Download gff for FMO06247.5prime
Subject Subject Range Query Range Percent Splice Strand
RpS28b-RA 79..287 1..211 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:41:12 Download gff for FMO06247.5prime
Subject Subject Range Query Range Percent Splice Strand
X 9554701..9554909 1..211 96   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:24:05 Download gff for FMO06247.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 9448734..9448942 1..211 96   Plus