Clone FMO06591 Report

Search the DGRC for FMO06591

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:65
Well:91
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG11368-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO06591.5prime Sequence

221 bp (221 high quality bases) assembled on 2008-09-24

> FMO06591.5prime
CAGTCGACATGCATCTGAACCTGAAATATTTCATTGGTCTGCTACTGGTG
CTGCTTTGCAGCTCTTTTGCGGTGGCCTATCCCCAGGGGCCTGGGTGTGG
TCCACCACCAAGTGGAACACCTCCGTCGGGACCGCGACCATCGGGTCCAC
CACCTGGAGGTCGCTGCGGACCACCACCATCGACCACGGCTGCATCTACC
GGTGCAAGCTTTCTAGACCAT

FMO06591.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:28:11
Subject Length Description Subject Range Query Range Score Percent Strand
CG11368-RA 361 CG11368-RA 29..223 9..203 960 99.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:28:09
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 7452373..7452505 71..203 650 99.2 Plus
X 23542271 X 7452237..7452301 9..73 325 100 Plus
Blast to na_te.dros performed on 2014-11-28 20:28:10 has no hits.

FMO06591.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:31:46 Download gff for FMO06591.5prime
Subject Subject Range Query Range Percent Splice Strand
CG11368-RA 29..230 9..212 97   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-09-24 09:38:47 Download gff for FMO06591.5prime
Subject Subject Range Query Range Percent Splice Strand
CG11368-RA 30..231 9..212 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:04:20 Download gff for FMO06591.5prime
Subject Subject Range Query Range Percent Splice Strand
CG11368-RA 29..230 9..212 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 21:04:20 Download gff for FMO06591.5prime
Subject Subject Range Query Range Percent Splice Strand
X 7452237..7452299 9..71 100 -> Plus
X 7452374..7452512 72..212 96   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:31:46 Download gff for FMO06591.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 7346270..7346332 9..71 100 -> Plus
arm_X 7346407..7346545 72..212 96   Plus