Clone FMO06592 Report

Search the DGRC for FMO06592

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:65
Well:92
Vector:pMK33-CFH-BD
Associated Gene/TranscriptIM2-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO06592.5prime Sequence

161 bp (161 high quality bases) assembled on 2008-09-24

> FMO06592.5prime
CAGTCGACATGAAGTTCTTCTCAGTCGTCACCGTCTTTGTGTTCGGTCTG
CTGGCTCTGGCCAACGCTGTTCCCCTGTCGCCCGATCCAGGAAATGTGGT
AATCAACGGGGACTGCAAATACTGCAATGTGCACGGTGGAAAGGCAAGCT
TTCTAGACCAT

FMO06592.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:08:22
Subject Length Description Subject Range Query Range Score Percent Strand
IM2-RA 367 CG18106-RA 72..206 9..143 675 100 Plus
IM1-RA 361 CG18108-RA 75..209 9..143 405 86.7 Plus
CG18107-RA 281 CG18107-RA 77..177 15..115 235 82.2 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:08:20
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 18386792..18386869 66..143 390 100 Plus
2R 25286936 2R 18386673..18386730 9..66 290 100 Plus
2R 25286936 2R 18384023..18384078 9..64 220 92.9 Plus
2R 25286936 2R 18384149..18384226 66..143 195 83.3 Plus
Blast to na_te.dros performed on 2014-11-28 19:08:21 has no hits.

FMO06592.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:24:41 Download gff for FMO06592.5prime
Subject Subject Range Query Range Percent Splice Strand
IM2-RA 62..206 1..143 97   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-09-24 09:38:49 Download gff for FMO06592.5prime
Subject Subject Range Query Range Percent Splice Strand
IM2-RA 67..211 1..143 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:00:45 Download gff for FMO06592.5prime
Subject Subject Range Query Range Percent Splice Strand
IM2-RA 62..206 1..143 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:00:45 Download gff for FMO06592.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 18386663..18386730 1..66 94 -> Plus
2R 18386793..18386869 67..143 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:24:41 Download gff for FMO06592.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 14274168..14274235 1..66 94 -> Plus
arm_2R 14274298..14274374 67..143 100   Plus