Clone FMO06736 Report

Search the DGRC for FMO06736

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:67
Well:36
Vector:pMK33-CFH-BD
Associated Gene/TranscripteIF6-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO06736.5prime Sequence

220 bp (-60 high quality bases) assembled on 2008-10-01

> FMO06736.5prime
GTATAGCATACCTCAATCACACTTATCAGTCGACTGGCTCTACGCGTCCA
ATTCTAGAACAACGACGACATCGGCGTCTTCACTAAACTAACCAACACAT
ACTGCCTGGTGGCCATCGGTGGATCCGACACCTTCTACAGCGCCTTCGAG
GCGGAGCTGGGCGACACCATCCCGGTGGTGCATGCGAATGTGGGCGGCTG
CCGGATCATCGGCCGCCTCA

FMO06736.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:19:49
Subject Length Description Subject Range Query Range Score Percent Strand
eIF6-RA 1056 CG17611-RA 231..416 35..220 900 98.9 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:19:47
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 23849886..23850071 220..35 900 98.9 Minus
Blast to na_te.dros performed on 2014-11-28 20:19:48 has no hits.

FMO06736.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:44:01 Download gff for FMO06736.5prime
Subject Subject Range Query Range Percent Splice Strand
eIF6-RA 225..415 28..219 96   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-10-01 13:28:47 Download gff for FMO06736.5prime
Subject Subject Range Query Range Percent Splice Strand
eIF6-RA 223..413 28..219 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:02:21 Download gff for FMO06736.5prime
Subject Subject Range Query Range Percent Splice Strand
eIF6-RA 225..415 28..219 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 21:02:21 Download gff for FMO06736.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 23849887..23850077 28..219 96   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:44:01 Download gff for FMO06736.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 19737410..19737600 28..219 96   Minus