Clone FMO06769 Report

Search the DGRC for FMO06769

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:67
Well:69
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG7789-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO06769.5prime Sequence

121 bp (-81 high quality bases) assembled on 2008-10-01

> FMO06769.5prime
TTTATCAGTCGACATGGCTGCAACTGCTCCGGTAATTATGCGCGTCATGG
CGTCCTCGATCAGCACCGCCAAGCGGGCTGGCGGCATCATACGCGACGTG
CTCAGAAGGGTGACCTGGGCA

FMO06769.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:07:04
Subject Length Description Subject Range Query Range Score Percent Strand
CG7789-RA 1130 CG7789-RA 107..215 14..121 520 99.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 23:07:02
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 29803302..29803410 14..121 495 99.1 Plus
Blast to na_te.dros performed on 2014-11-28 23:07:03 has no hits.

FMO06769.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:16:47 Download gff for FMO06769.5prime
Subject Subject Range Query Range Percent Splice Strand
CG7789-RA 107..214 14..120 99   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-10-01 13:27:33 Download gff for FMO06769.5prime
Subject Subject Range Query Range Percent Splice Strand
CG7789-RA 106..213 14..120 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:50:30 Download gff for FMO06769.5prime
Subject Subject Range Query Range Percent Splice Strand
CG7789-RA 107..214 14..120 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 23:50:30 Download gff for FMO06769.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 29803302..29803409 14..120 99   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:16:47 Download gff for FMO06769.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 25629024..25629131 14..120 99   Plus