Clone FMO07501 Report

Search the DGRC for FMO07501

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:75
Well:1
Vector:pMK33-CFH-BD
Associated Gene/TranscriptNeb-cGP-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO07501.5prime Sequence

170 bp (170 high quality bases) assembled on 2008-10-22

> FMO07501.5prime
CAGTCGACATGGCTGGCGAAGGCGAGAAACTGACCGGCCTGTCGAAAATC
TTCAATGGCACCACCATGAGCGGCCGTGCAAATGTGGCCAAGGCCACGTA
CGCCGTGATGGGCCTGCTGATCGCCTACCAGGTGCTGAAGCCCAAGAAGA
AGGCAAGCTTTCTAGACCAT

FMO07501.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:41:48
Subject Length Description Subject Range Query Range Score Percent Strand
Neb-cGP-RB 987 CG15304-RB 116..259 9..152 720 100 Plus
Neb-cGP-RA 410 CG15304-RA 116..259 9..152 720 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:41:46
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 10460922..10460999 9..86 390 100 Plus
X 23542271 X 10461082..10461150 84..152 345 100 Plus
Blast to na_te.dros performed on 2014-11-28 20:41:47 has no hits.

FMO07501.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-12-21 15:07:39 Download gff for FMO07501.5prime
Subject Subject Range Query Range Percent Splice Strand
Neb-cGP-RA 108..251 9..152 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:35:54 Download gff for FMO07501.5prime
Subject Subject Range Query Range Percent Splice Strand
Neb-cGP-RA 116..259 9..152 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:26:00 Download gff for FMO07501.5prime
Subject Subject Range Query Range Percent Splice Strand
Neb-cGP-RA 116..259 9..152 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 21:26:00 Download gff for FMO07501.5prime
Subject Subject Range Query Range Percent Splice Strand
X 10460915..10460996 1..83 95 -> Plus
X 10461082..10461150 84..152 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:35:54 Download gff for FMO07501.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 10354948..10355029 1..83 95 -> Plus
arm_X 10355115..10355183 84..152 100   Plus