Clone FMO07512 Report

Search the DGRC for FMO07512

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:75
Well:12
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRpS29-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO07512.5prime Sequence

194 bp (194 high quality bases) assembled on 2008-10-22

> FMO07512.5prime
CAGTCGACATGGGTTTCGCTACTCTCTGGTACTCGCATCCCCGCAAATAT
GGCCAAGGCTCCCGATGCTGCCGTGCCTGCTCTAACCGCCACGGTCTGAT
CCGCAAGTATGGCCTTAACATCTGCCGCCAGTGCTTCAGGGAGTACGCCA
ACGACATTGGCTTCAAGAAGCTGGACGCAAGCTTTCTAGACCAT

FMO07512.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:39:17
Subject Length Description Subject Range Query Range Score Percent Strand
RpS29-RB 1007 CG8495-RB 92..261 7..176 850 100 Plus
RpS29-RA 502 CG8495-RA 37..206 7..176 850 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:39:15
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 9778618..9778718 70..170 505 100 Plus
3R 32079331 3R 9778133..9778196 7..70 320 100 Plus
Blast to na_te.dros performed on 2014-11-28 22:39:16 has no hits.

FMO07512.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-12-21 15:07:37 Download gff for FMO07512.5prime
Subject Subject Range Query Range Percent Splice Strand
RpS29-RA 33..210 1..180 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:06:42 Download gff for FMO07512.5prime
Subject Subject Range Query Range Percent Splice Strand
RpS29-RA 32..209 1..180 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:21:26 Download gff for FMO07512.5prime
Subject Subject Range Query Range Percent Splice Strand
RpS29-RA 32..209 1..180 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 23:21:26 Download gff for FMO07512.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 9778128..9778196 1..70 95 -> Plus
3R 9778619..9778721 71..173 99   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:06:42 Download gff for FMO07512.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 5603850..5603918 1..70 95 -> Plus
arm_3R 5604341..5604443 71..173 99   Plus