Clone FMO07563 Report

Search the DGRC for FMO07563

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:75
Well:63
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCecC-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO07563.5prime Sequence

215 bp (215 high quality bases) assembled on 2008-10-22

> FMO07563.5prime
CAGTCGACATGAACTTCTACAAGATCTTCGTTTTCGTCGCCCTCATCCTG
GCCATCAGCATTGGACAATCGGAAGCCGGTTGGCTGAAGAAACTTGGCAA
GAGAATCGAGCGCATTGGCCAGCACACCCGGGATGCAACCATTCAAGGAC
TGGGAATTGCGCAACAGGCCGCCAATGTGGCAGCCACCGCCAGAGGAGCA
AGCTTTCTAGACCAT

FMO07563.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:01:21
Subject Length Description Subject Range Query Range Score Percent Strand
CecC-RA 386 CG1373-RA 93..282 8..197 950 100 Plus
CecA1-RA 339 CG1365-RA 74..262 8..196 585 87.3 Plus
CecA2-RA 355 CG1367-RA 82..261 8..187 570 87.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:01:20
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 30216576..30216676 8..108 505 100 Plus
3R 32079331 3R 30216745..30216834 108..197 450 100 Plus
3R 32079331 3R 30210947..30211047 8..108 385 92.1 Plus
3R 32079331 3R 30212237..30212337 8..108 385 92.1 Plus
3R 32079331 3R 30213626..30213730 108..4 225 81 Minus
3R 32079331 3R 30211111..30211196 111..196 205 82.6 Plus
3R 32079331 3R 30212402..30212474 115..187 200 84.9 Plus
3R 32079331 3R 30213486..30213565 190..111 190 82.5 Minus
Blast to na_te.dros performed on 2014-11-28 20:01:20 has no hits.

FMO07563.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-12-21 15:06:45 Download gff for FMO07563.5prime
Subject Subject Range Query Range Percent Splice Strand
CecC-RA 86..290 1..206 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:23:05 Download gff for FMO07563.5prime
Subject Subject Range Query Range Percent Splice Strand
CecC-RA 86..290 1..206 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:46:27 Download gff for FMO07563.5prime
Subject Subject Range Query Range Percent Splice Strand
CecC-RA 86..290 1..206 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:46:27 Download gff for FMO07563.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 30216569..30216675 1..107 96 -> Plus
3R 30216745..30216842 108..206 96   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:23:05 Download gff for FMO07563.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 26042291..26042397 1..107 96 -> Plus
arm_3R 26042467..26042564 108..206 96   Plus