Clone FMO07568 Report

Search the DGRC for FMO07568

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:75
Well:68
Vector:pMK33-CFH-BD
Associated Gene/Transcriptsun-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO07568.5prime Sequence

209 bp (209 high quality bases) assembled on 2008-10-22

> FMO07568.5prime
CAGTCGACATGACTGCCTGGAGAGCTGCCGGAATTACCTACATCCAATAC
TCCAACATCGCCGCTCGCATTTTGCGCGAGTCCTTGAAGACGGGACTGCG
TGCGGATGCCGCCAAGCGCGACGCGAGCCATGTGAAGTTCACTCCCTGGG
CAAATGGCAAGCCAGCTCAGCGTCAAACCCAATCGGAATCCGCAAGCTTT
CTAGACCAT

FMO07568.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:59:47
Subject Length Description Subject Range Query Range Score Percent Strand
sun-RA 400 CG9032-RA 95..277 9..191 915 100 Plus
sun-RB 450 CG9032-RB 95..255 9..169 805 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:59:45
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 15848886..15849016 168..38 655 100 Minus
3R 32079331 3R 10122032..10122180 15..163 190 75.2 Plus
Blast to na_te.dros performed on 2014-11-28 18:59:46 has no hits.

FMO07568.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-12-21 15:06:50 Download gff for FMO07568.5prime
Subject Subject Range Query Range Percent Splice Strand
sun-RA 68..269 1..200 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:29:27 Download gff for FMO07568.5prime
Subject Subject Range Query Range Percent Splice Strand
sun-RA 86..287 1..200 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:44:17 Download gff for FMO07568.5prime
Subject Subject Range Query Range Percent Splice Strand
sun-RA 86..287 1..200 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:44:17 Download gff for FMO07568.5prime
Subject Subject Range Query Range Percent Splice Strand
X 15848886..15849016 38..168 100 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:29:27 Download gff for FMO07568.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 15742919..15743049 38..168 100 <- Minus