Clone FMO07576 Report

Search the DGRC for FMO07576

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:75
Well:76
Vector:pMK33-CFH-BD
Associated Gene/TranscriptTom7-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO07576.5prime Sequence

188 bp (188 high quality bases) assembled on 2008-10-22

> FMO07576.5prime
CAGTCGACATGAAGCTATCCGAGGGAGTTAAGGATCGTTTGGGATTTGTG
GTTGGAGTCGTCCAGACTGGATTCCACTGGGGATTCGTGCCTCTTGTGCT
GTATTTGGGATTTATGAAGGGAGCTGAGCCTGGCATGCCGCCTCTGAACC
TTTTCAGTCTGTTATGGCAGGCAAGCTTTCTAGACCAT

FMO07576.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:41:28
Subject Length Description Subject Range Query Range Score Percent Strand
Tom7-RB 539 CG8226-RB 195..360 5..170 815 99.4 Plus
Tom7-RA 355 CG8226-RA 73..238 5..170 815 99.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:41:27
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 8951789..8951893 5..109 510 99 Plus
2R 25286936 2R 8952001..8952063 108..170 315 100 Plus
Blast to na_te.dros performed on 2014-11-28 20:41:28 has no hits.

FMO07576.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-12-21 15:07:00 Download gff for FMO07576.5prime
Subject Subject Range Query Range Percent Splice Strand
Tom7-RA 97..270 1..174 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:35:42 Download gff for FMO07576.5prime
Subject Subject Range Query Range Percent Splice Strand
Tom7-RA 68..241 1..174 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:25:49 Download gff for FMO07576.5prime
Subject Subject Range Query Range Percent Splice Strand
Tom7-RA 68..241 1..174 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 21:25:49 Download gff for FMO07576.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 8951784..8951892 1..108 97 -> Plus
2R 8952002..8952066 109..174 96   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:35:42 Download gff for FMO07576.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 4839289..4839397 1..108 97 -> Plus
arm_2R 4839507..4839571 109..174 96   Plus