Clone FMO07632 Report

Search the DGRC for FMO07632

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:76
Well:32
Vector:pMK33-CFH-BD
Associated Gene/Transcript
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO07632.5prime Sequence

176 bp (176 high quality bases) assembled on 2008-11-03

> FMO07632.5prime
CAGTCGACATGCCGAAAGCGGAGTGCGAGATGCTCGTGGTTAAGGTCATG
GCAACTACGGACATGGCAACTACGGACATGGCAACTACGGACATGGTCAT
CACGGGGGTGGTGGTCATGGACATGGACATTATGGTCGCTAGTGTATTTA
TACATTTTGCAAGCTTTCTAGACCAT

FMO07632.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed on 2014-11-28 20:35:51 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:35:49
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 11246289..11246440 7..158 760 100 Plus
Blast to na_te.dros performed on 2014-11-28 20:35:50 has no hits.

FMO07632.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-12-21 15:14:59 Download gff for FMO07632.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34226-RA 167..328 1..165 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 21:06:44 Download gff for FMO07632.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 11246285..11246446 1..165 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 21:06:44 Download gff for FMO07632.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 11246285..11246446 1..165 96   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:48:11 Download gff for FMO07632.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 7133790..7133951 1..165 96   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:48:11 Download gff for FMO07632.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 7133790..7133951 1..165 96   Plus