Clone FMO07941 Report

Search the DGRC for FMO07941

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:79
Well:41
Vector:pMK33-CFH-BD
Associated Gene/TranscriptIM4-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO07941.5prime Sequence

152 bp (152 high quality bases) assembled on 2009-09-01

> FMO07941.5prime
CAGTCGACATGAAGTTCTTCCAAGCCGCCGCCCTTCTCTTGGCCATGTTC
GCTGCCCTCGCCAACGCCGAGCCCGTTCCCCAACCTGGAACCGTGCTCAT
CCAGACCGACAACACCCAGTACATTCGTACTGGTGCAAGCTTTCTAGACC
AT

FMO07941.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:26:41
Subject Length Description Subject Range Query Range Score Percent Strand
IM4-RB 767 CG15231-RB 63..190 7..134 640 100 Plus
IM4-RA 418 CG15231-RA 63..190 7..134 640 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:26:38
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 20869182..20869259 84..7 390 100 Minus
2R 25286936 2R 20869073..20869122 134..85 250 100 Minus
Blast to na_te.dros performed on 2014-11-28 19:26:39 has no hits.

FMO07941.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-10-05 15:17:47 Download gff for FMO07941.5prime
Subject Subject Range Query Range Percent Splice Strand
IM4-RA 57..197 1..142 95   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:20:08 Download gff for FMO07941.5prime
Subject Subject Range Query Range Percent Splice Strand
IM4-RA 57..197 1..142 95   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:58:10 Download gff for FMO07941.5prime
Subject Subject Range Query Range Percent Splice Strand
IM4-RA 57..197 1..142 95   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:58:10 Download gff for FMO07941.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 20869066..20869122 85..142 93 <- Minus
2R 20869182..20869263 1..84 96   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:20:08 Download gff for FMO07941.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 16756571..16756627 85..142 93 <- Minus
arm_2R 16756687..16756768 1..84 96   Minus