Clone FMO07953 Report

Search the DGRC for FMO07953

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:79
Well:53
Vector:pMK33-CFH-BD
Associated Gene/TranscriptIM3-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO07953.5prime Sequence

143 bp (143 high quality bases) assembled on 2009-09-01

> FMO07953.5prime
CAGTCGACATGAAATTCCTATCACTCGCCTTCGTTTTGGGTCTGCTGGCT
CTGGCCAACGCCACTCCCCTGAATCCTGGCAATGTCATCATCAATGGCGA
TTGCCGCGTCTGCAATGTGAGGGCCGCAAGCTTTCTAGACCAT

FMO07953.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:26:33
Subject Length Description Subject Range Query Range Score Percent Strand
IM3-RB 769 CG16844-RB 289..407 7..125 595 100 Plus
IM3-RA 301 CG16844-RA 65..183 7..125 595 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:26:31
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 18388307..18388372 60..125 330 100 Plus
2R 25286936 2R 18388183..18388236 7..60 270 100 Plus
Blast to na_te.dros performed on 2014-11-28 19:26:32 has no hits.

FMO07953.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-10-05 15:21:13 Download gff for FMO07953.5prime
Subject Subject Range Query Range Percent Splice Strand
IM3-RA 59..186 1..130 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:20:05 Download gff for FMO07953.5prime
Subject Subject Range Query Range Percent Splice Strand
IM3-RA 60..187 1..130 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:58:05 Download gff for FMO07953.5prime
Subject Subject Range Query Range Percent Splice Strand
IM3-RA 60..187 1..130 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:58:05 Download gff for FMO07953.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 18388178..18388236 1..60 95 -> Plus
2R 18388308..18388376 61..130 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:20:05 Download gff for FMO07953.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 14275683..14275741 1..60 95 -> Plus
arm_2R 14275813..14275881 61..130 97   Plus