Clone FMO08024 Report

Search the DGRC for FMO08024

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:80
Well:24
Vector:pMK33-CFH-BD
Associated Gene/TranscriptMtnB-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO08024.5prime Sequence

155 bp (155 high quality bases) assembled on 2009-09-01

> FMO08024.5prime
CAGTCGACATGGTTTGCAAGGGTTGTGGAACAAACTGCCAGTGCTCGGCC
CAAAAGTGCGGGGACAACTGCGCCTGCAACAAGGATTGCCAGTGCGTTTG
CAAGAATGGGCCCAAGGACCAGTGCTGCAGCAACAAAGCAAGCTTTCTAG
ACCAT

FMO08024.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:17:52
Subject Length Description Subject Range Query Range Score Percent Strand
MtnB-RC 456 CG4312-RC 89..217 9..137 645 100 Plus
MtnB-RB 448 CG4312-RB 217..345 9..137 645 100 Plus
MtnB-RA 320 CG4312-RA 89..217 9..137 645 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:17:50
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 20503341..20503448 137..30 525 99.1 Minus
3R 32079331 3R 20535108..20535202 34..128 235 83.2 Plus
3R 32079331 3R 20360450..20360525 54..129 200 84.2 Plus
Blast to na_te.dros performed on 2014-11-28 22:17:51 has no hits.

FMO08024.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-10-05 15:18:49 Download gff for FMO08024.5prime
Subject Subject Range Query Range Percent Splice Strand
MtnB-RA 62..203 1..143 95   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:02:10 Download gff for FMO08024.5prime
Subject Subject Range Query Range Percent Splice Strand
MtnB-RA 81..222 1..143 95   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:47:29 Download gff for FMO08024.5prime
Subject Subject Range Query Range Percent Splice Strand
MtnB-RA 81..222 1..143 95   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:47:29 Download gff for FMO08024.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 20503336..20503444 34..143 98 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:02:10 Download gff for FMO08024.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 16329058..16329166 34..143 98 <- Minus