Clone FMO08058 Report

Search the DGRC for FMO08058

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:80
Well:58
Vector:pMK33-CFH-BD
Associated Gene/Transcripta10-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO08058.5prime Sequence

113 bp (-16 high quality bases) assembled on 2009-09-01

> FMO08058.5prime
CAATCCACATGGGACAGCCCGGTTTCCGTCGCGCCATTGGGCACGTTTCG
TTGGTGGTGGCACTGATGTGCACCACCTGTTTCCAAGTGGAAGGACTACC
CCATCCGCCGGCC

FMO08058.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:29:11
Subject Length Description Subject Range Query Range Score Percent Strand
a10-RA 567 CG6642-RA 21..125 9..113 510 99 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:29:10
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 17023617..17023721 113..9 510 99 Minus
Blast to na_te.dros performed on 2014-11-28 20:29:10 has no hits.

FMO08058.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-10-05 15:18:28 Download gff for FMO08058.5prime
Subject Subject Range Query Range Percent Splice Strand
a10-RA 21..125 9..113 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:43:34 Download gff for FMO08058.5prime
Subject Subject Range Query Range Percent Splice Strand
a10-RA 21..125 9..113 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:03:05 Download gff for FMO08058.5prime
Subject Subject Range Query Range Percent Splice Strand
a10-RA 21..125 9..113 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 21:03:05 Download gff for FMO08058.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 17023617..17023721 9..113 99   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:43:34 Download gff for FMO08058.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 17016717..17016821 9..113 99   Minus