FMO08058.5prime Sequence
113 bp (-16 high quality bases) assembled on 2009-09-01
> FMO08058.5prime
CAATCCACATGGGACAGCCCGGTTTCCGTCGCGCCATTGGGCACGTTTCG
TTGGTGGTGGCACTGATGTGCACCACCTGTTTCCAAGTGGAAGGACTACC
CCATCCGCCGGCC
FMO08058.5prime Blast Records
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:29:11
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
a10-RA | 567 | CG6642-RA | 21..125 | 9..113 | 510 | 99 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:29:10
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3L | 28110227 | 3L | 17023617..17023721 | 113..9 | 510 | 99 | Minus |
Blast to na_te.dros performed on 2014-11-28 20:29:10 has no hits.
FMO08058.5prime Sim4 Records
Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-10-05 15:18:28 Download gff for
FMO08058.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
a10-RA | 21..125 | 9..113 | 99 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:43:34 Download gff for
FMO08058.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
a10-RA | 21..125 | 9..113 | 99 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:03:05 Download gff for
FMO08058.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
a10-RA | 21..125 | 9..113 | 99 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 21:03:05 Download gff for
FMO08058.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3L | 17023617..17023721 | 9..113 | 99 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:43:34 Download gff for
FMO08058.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3L | 17016717..17016821 | 9..113 | 99 | | Minus |