Clone FMO08160 Report

Search the DGRC for FMO08160

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:81
Well:60
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG6503-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO08160.5prime Sequence

212 bp (212 high quality bases) assembled on 2010-03-10

> FMO08160.5prime
CAGTCGACATGCTTTTGAAATGCACTTGGCTATTGGTTTTGCTGCTGTCC
GTAATGGCAGGTGCCTTTGCCAGCAGCGGATGTCCTGCGGGATATAGTGC
CGAGAACAATCGGTGCACCATTGAGCGTCCTGTTCACGGCTCCTGTCCAC
CCGGATCCTCCTACAGCCTGAACATCAACAAGTGCGTCCACTCCGCAAGC
TTTCTAGACCAT

FMO08160.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:20:03
Subject Length Description Subject Range Query Range Score Percent Strand
CG6503-RB 348 CG6503-RB 48..235 7..194 940 100 Plus
CG6503-RC 353 CG6503-RC 53..240 7..194 940 100 Plus
CG6503-RA 408 CG6503-RA 108..295 7..194 940 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:20:01
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 26424811..26424998 194..7 940 100 Minus
Blast to na_te.dros performed on 2014-11-28 22:20:02 has no hits.

FMO08160.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-08-03 10:31:11 Download gff for FMO08160.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6503-RA 103..299 1..199 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:59:05 Download gff for FMO08160.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6503-RA 103..299 1..199 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:56:12 Download gff for FMO08160.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6503-RA 103..299 1..199 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:56:12 Download gff for FMO08160.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 26424807..26425002 1..199 96   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:59:05 Download gff for FMO08160.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 22250529..22250724 1..199 96   Minus