Clone FMO08169 Report

Search the DGRC for FMO08169

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:81
Well:69
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG6000-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO08169.5prime Sequence

134 bp (134 high quality bases) assembled on 2010-03-10

> FMO08169.5prime
CAGTCGACATGGCCGGGAAAAACCGAAGCCAGAAACGGAGATTATATTCC
ACTGCAAGATTGGCAAAAGAAGCCTTAAGGCTGCAGAAGCTGCCGCCGCA
TTGGGATTCAAGAATGGCAAGCTTTCTAGACCAT

FMO08169.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:56:21
Subject Length Description Subject Range Query Range Score Percent Strand
CG6000-RC 644 CG6000-RC 403..510 9..116 540 100 Plus
CG6000-RD 702 CG6000-RD 403..510 9..116 540 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 21:56:19
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 24054793..24054900 9..116 540 100 Plus
Blast to na_te.dros performed on 2014-11-28 21:56:20 has no hits.

FMO08169.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-08-03 10:33:00 Download gff for FMO08169.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6000-RA 281..393 9..121 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:50:22 Download gff for FMO08169.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6000-RD 403..515 9..121 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:37:38 Download gff for FMO08169.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6000-RD 403..515 9..121 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:37:38 Download gff for FMO08169.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 24054793..24054905 9..121 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:50:22 Download gff for FMO08169.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 19880515..19880627 9..121 98   Plus