Clone FMO08269 Report

Search the DGRC for FMO08269

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:82
Well:69
Vector:pMK33-CFH-BD
Associated Gene/Transcripthep-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO08269.5prime Sequence

129 bp (129 high quality bases) assembled on 2010-03-11

> FMO08269.5prime
CAGTCGACATGCAGCGAAAACTGAGCAACGGATCCCATCATCCGCACTAC
AAATATAACGACGAGAGCCCCAAGAAGGAGTCCATGTTTAGTAGCATCGG
TGGGTTTGGCTCTATAGATTTAGATTTAG

FMO08269.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:03:01
Subject Length Description Subject Range Query Range Score Percent Strand
hep-RE 5689 CG4353-RE 3317..3410 8..101 470 100 Plus
hep-RD 5344 CG4353-RD 2521..2614 8..101 470 100 Plus
hep-RF 5344 CG4353-RF 2521..2614 8..101 470 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:02:58
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 13082578..13082699 129..8 610 100 Minus
Blast to na_te.dros performed on 2014-11-28 20:02:59 has no hits.

FMO08269.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-08-02 18:41:53 Download gff for FMO08269.5prime
Subject Subject Range Query Range Percent Splice Strand
hep-RB 14..142 1..129 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:41:25 Download gff for FMO08269.5prime
Subject Subject Range Query Range Percent Splice Strand
hep-RF 2514..2614 1..101 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:52:46 Download gff for FMO08269.5prime
Subject Subject Range Query Range Percent Splice Strand
hep-RF 2514..2614 1..101 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:52:46 Download gff for FMO08269.5prime
Subject Subject Range Query Range Percent Splice Strand
X 13082578..13082703 1..129 96   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:41:25 Download gff for FMO08269.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 12976611..12976736 1..129 96   Minus