Clone FMO08316 Report

Search the DGRC for FMO08316

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:83
Well:16
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG14104-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO08316.5prime Sequence

230 bp (230 high quality bases) assembled on 2010-06-02

> FMO08316.5prime
CAGTCGACATGAAAGAAAATAAGAAAAAGTCGCGCAAAACGGCCAATAAG
ACAAATGAAACGTCAGAGGGTCAGAAAAAGAAGATCATTGAACTGCTGCA
CGAGTACAACGACCTAAAGGATGCCACCCAGCGCGTCCTGGAAGCCTTGG
CCAACCTAAAATGCGTACCCGTCGGATCGGTTTACGCTACATACAACCTG
CCCCGCGACGAAGCAAGCTTTCTAGACCAT

FMO08316.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:27:37
Subject Length Description Subject Range Query Range Score Percent Strand
CG14104-RB 389 CG14104-RB 52..257 7..212 1030 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:27:35
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 19806943..19807148 212..7 1030 100 Minus
Blast to na_te.dros performed 2014-11-28 19:27:36
Subject Length Description Subject Range Query Range Score Percent Strand
Dmir\worf 4174 Dmir\worf WORF 4174bp Derived from AY144572. 3344..3373 93..65 102 86.7 Minus

FMO08316.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-08-02 18:23:22 Download gff for FMO08316.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14104-RB 49..262 7..221 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:29:13 Download gff for FMO08316.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14104-RB 52..265 7..221 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:16:38 Download gff for FMO08316.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14104-RB 52..265 7..221 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:16:38 Download gff for FMO08316.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 19806935..19807148 7..221 98   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:29:13 Download gff for FMO08316.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 19800035..19800248 7..221 98   Minus