Clone FMO08673 Report

Search the DGRC for FMO08673

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:86
Well:73
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG33468-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO08673.5prime Sequence

148 bp (148 high quality bases) assembled on 2010-06-21

> FMO08673.5prime
CAGTCGACATGACAACATCTGCTGTTGAAGCTCCCAATAGTGCATATCCC
GATTTAGAAAAGCGACTGGAAAGGTATTTGCGAAGTGTGTTTTGCCTAAA
GGAAATCGATACTAAAAATGAGTACATTCCAACCGAAGTGGAGTACTT

FMO08673.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:44:03
Subject Length Description Subject Range Query Range Score Percent Strand
CG33468-RA 607 CG33468-RA 22..161 9..148 700 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:44:01
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 14606753..14606861 148..40 545 100 Minus
Blast to na_te.dros performed 2014-11-28 19:44:02
Subject Length Description Subject Range Query Range Score Percent Strand
gypsy 7469 gypsy DMGYPF1A 7469bp Derived from M12927 (g157583) (Rel. 44, Last updated, Version 6). 2326..2364 100..138 105 74.4 Plus

FMO08673.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-08-02 18:24:41 Download gff for FMO08673.5prime
Subject Subject Range Query Range Percent Splice Strand
CG33468-RA 1..140 9..148 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:43:18 Download gff for FMO08673.5prime
Subject Subject Range Query Range Percent Splice Strand
CG33468-RA 17..161 4..148 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:18:37 Download gff for FMO08673.5prime
Subject Subject Range Query Range Percent Splice Strand
CG33468-RA 17..161 4..148 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:18:37 Download gff for FMO08673.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 14606753..14606861 40..148 100 <- Minus
2R 14606929..14606964 4..39 94   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:43:18 Download gff for FMO08673.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 10494258..10494366 40..148 100 <- Minus
arm_2R 10494434..10494469 4..39 94   Minus