Clone FMO08757 Report

Search the DGRC for FMO08757

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:87
Well:57
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG34228-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO08757.5prime Sequence

290 bp (290 high quality bases) assembled on 2010-06-29

> FMO08757.5prime
CAGTCGACATGTGGCCAATTGTTATGGCTCTAATTAGGCGTAACGCCGTT
TACATCACGTTGCCCATAGCCGGCGTTGTGGGTTTTATTGGCTATAACAT
AGAGAGTTGGATATCTGACAAATACACCCCATACAGTCCATCCATACAAG
AGTTGCGCGCTAAACGGTTGACAGAAGAAAGTTTGAATACAGATGCCGCT
AATGTGGAAAAATTACGACTGAGTAGTCCCGTACTGGAACGCAACCTCTC
CCCGTCGCTACAGCCCAAGGCCGCAAGCTTTCTAGACCAT

FMO08757.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:48:18
Subject Length Description Subject Range Query Range Score Percent Strand
CG34228-RA 415 CG34228-RA 86..349 9..272 1320 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:48:16
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 11652140..11652273 139..272 670 100 Plus
2R 25286936 2R 11651942..11652071 9..138 650 100 Plus
Blast to na_te.dros performed on 2014-11-28 19:48:17 has no hits.

FMO08757.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-08-02 18:30:53 Download gff for FMO08757.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34228-RA 58..332 1..276 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:41:54 Download gff for FMO08757.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34228-RA 78..352 1..276 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:27:39 Download gff for FMO08757.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34228-RA 78..352 1..276 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:27:39 Download gff for FMO08757.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 11651934..11652071 1..138 97 -> Plus
2R 11652140..11652276 139..276 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:41:54 Download gff for FMO08757.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 7539439..7539576 1..138 97 -> Plus
arm_2R 7539645..7539781 139..276 98   Plus