Clone FMO08759 Report

Search the DGRC for FMO08759

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:87
Well:59
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG34208-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO08759.5prime Sequence

176 bp (176 high quality bases) assembled on 2010-06-29

> FMO08759.5prime
CAGTCGACATGAAGTGGCTTAGTTTGTTCCTGGTATTCGGCATCCTCGGA
CTCATCGGCAGTCTGGGCACTTTAGCCCTAGCGGAACCCAATCCGGAGCC
CAAGGGTCGTCCGCACACAACGCGACGTCCTCGAAACGATAACGACAACG
ATCGACGCGCAAGCTTTCTAGACCAT

FMO08759.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:00:11
Subject Length Description Subject Range Query Range Score Percent Strand
CG34208-RA 380 CG34208-RA 23..176 5..158 755 99.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:00:09
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 22333148..22333301 5..158 755 99.4 Plus
Blast to na_te.dros performed on 2014-11-28 22:00:10 has no hits.

FMO08759.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-08-02 18:31:04 Download gff for FMO08759.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34208-RA 21..182 1..162 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:41:18 Download gff for FMO08759.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34208-RA 21..182 1..162 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:55:55 Download gff for FMO08759.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34208-RA 21..182 1..162 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:55:55 Download gff for FMO08759.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 22333146..22333307 1..162 96   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:41:18 Download gff for FMO08759.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 18220651..18220812 1..162 96   Plus