Clone FMO08809 Report

Search the DGRC for FMO08809

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:88
Well:9
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG34439-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO08809.5prime Sequence

245 bp (245 high quality bases) assembled on 2010-08-03

> FMO08809.5prime
CAGTCGACATGTGGTTCGAAATCCTACCTGGTGCGGTGATCATCACCACG
CTCCTCTCGGTGCCCATATACGCCATGTACGGCCTGGACAAGCTGATGAT
CGGCAATGCTTTCCGGCGCAACATGGACGAGCGTTTCAGCCGAGTTATGT
ACCAGCGCGATTTCCGACTGACCGACAATCCCTACAAGATGAACGGTCTG
GATGCCATACCGGATGAGAAAACGAACGCAAGCTTTCTAGACCAT

FMO08809.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:43:44
Subject Length Description Subject Range Query Range Score Percent Strand
CG34439-RA 384 CG34439-RA 83..301 9..227 1095 100 Plus
CG34439-RB 728 CG34439-RB 83..273 9..199 955 100 Plus
TppII-RD 4641 CG3991-RD 38..125 195..108 440 100 Minus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:43:42
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 13158748..13158847 9..108 500 100 Plus
2R 25286936 2R 13159017..13159104 108..195 440 100 Plus
Blast to na_te.dros performed on 2014-11-28 19:43:43 has no hits.

FMO08809.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-08-03 15:22:14 Download gff for FMO08809.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34439-RA 136..360 9..236 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:39:09 Download gff for FMO08809.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34439-RA 83..307 9..236 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:25:10 Download gff for FMO08809.5prime
Subject Subject Range Query Range Percent Splice Strand
CG34439-RA 83..307 9..236 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:25:10 Download gff for FMO08809.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 13158748..13158846 9..107 100 -> Plus
2R 13159017..13159103 108..194 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:39:09 Download gff for FMO08809.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 9046253..9046351 9..107 100 -> Plus
arm_2R 9046522..9046608 108..194 100 -> Plus