Clone FMO08916 Report

Search the DGRC for FMO08916

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:89
Well:16
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG17580-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO08916.5prime Sequence

245 bp (245 high quality bases) assembled on 2010-08-03

> FMO08916.5prime
CAGTCGACATGGGAAACAAGCTGCGCCGCCAACCACAAAGAGTTGAAGTT
GACGAGGAGGAGGTGAGATCCGACCGACCCCAGAAGAAGCCACCATCGTC
ATGGCCCTTCTGGCGCCTGGTCTACTGGCTGGGAGTCCTCATCATGGTCA
TCGGCATCGGTGTGGGCATGTACTTCACCCTCAAGTCGGACTTCGGTGAG
TGCTCCTCCTACGACGTCCGTTGCGATGCAAGCTTTCTAGACCAT

FMO08916.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:39:59
Subject Length Description Subject Range Query Range Score Percent Strand
CG17580-RA 1086 CG17580-RA 85..303 9..227 1095 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 21:39:57
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 12806698..12806916 9..227 1095 100 Plus
Blast to na_te.dros performed on 2014-11-28 21:39:58 has no hits.

FMO08916.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-08-03 15:23:48 Download gff for FMO08916.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17580-RA 15..240 1..227 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:40:52 Download gff for FMO08916.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17580-RA 78..303 1..227 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:29:21 Download gff for FMO08916.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17580-RA 78..303 1..227 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:29:21 Download gff for FMO08916.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 12806691..12806916 1..227 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:40:52 Download gff for FMO08916.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 8694196..8694421 1..227 98   Plus