Clone FMO09004 Report

Search the DGRC for FMO09004

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:90
Well:4
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRpL29-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO09004.5prime Sequence

254 bp (254 high quality bases) assembled on 2010-08-09

> FMO09004.5prime
CAGTCGACATGGCCAAGTCCAAGAACCACACAAATCACAACCAGAACAAG
AAGGCCCATCGTAATGGCATCAAGCGCCCGCTGCGCAAACGCCACGAGTC
CACTCTGGGTATGGATGTGAAATTCCTGATCAACCAGCGCTACGCACGCA
AGGGAAACCTTTCCCGCGAGGAGTCCGTGAAGCGCTACAACGAGCGCATC
GCTTCCCAGAAGGGCAAGCCAAAGCCTGTTACTCTGGCAAGCTTTCTAGA
CCAT

FMO09004.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:38:12
Subject Length Description Subject Range Query Range Score Percent Strand
RpL29-RD 304 CG10071-RD 29..256 9..236 1125 99.6 Plus
RpL29-RB 389 CG10071-RB 114..341 9..236 1125 99.6 Plus
RpL29-RA 329 CG10071-RA 54..281 9..236 1125 99.6 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 23:38:10
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 21294231..21294356 111..236 615 99.2 Plus
2R 25286936 2R 21294060..21294161 9..110 510 100 Plus
Blast to na_te.dros performed on 2014-11-28 23:38:11 has no hits.

FMO09004.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-08-17 15:36:29 Download gff for FMO09004.5prime
Subject Subject Range Query Range Percent Splice Strand
RpL29-RB 99..326 9..236 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:09:43 Download gff for FMO09004.5prime
Subject Subject Range Query Range Percent Splice Strand
RpL29-RA 54..281 9..236 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-29 00:09:31 Download gff for FMO09004.5prime
Subject Subject Range Query Range Percent Splice Strand
RpL29-RA 54..281 9..236 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-29 00:09:31 Download gff for FMO09004.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 21294060..21294161 9..110 100 -> Plus
2R 21294231..21294356 111..236 99   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:09:43 Download gff for FMO09004.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 17181565..17181666 9..110 100 -> Plus
arm_2R 17181736..17181861 111..236 99   Plus