Clone FMO09006 Report

Search the DGRC for FMO09006

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:90
Well:6
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG42305-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO09006.5prime Sequence

170 bp (170 high quality bases) assembled on 2010-08-09

> FMO09006.5prime
CAGTCGACATGAAGACACCGGACACCAAAGCCAAGTTGCTGAATAATATA
AGTCTATCTAAACACCTGTCTTCCAAGAAAGGCGGCTCTCGCACTAGTAA
CTGCGGCAATTGTCTGGAATTCTCCGTACTCACGCGTCTCTCCAGCGTGC
CCGCAAGCTTTCTAGACCAT

FMO09006.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:38:06
Subject Length Description Subject Range Query Range Score Percent Strand
CG42305-RC 1018 CG42305-RC 453..596 9..152 720 100 Plus
CG42305-RB 779 CG42305-RB 92..235 9..152 720 100 Plus
CG42305-RA 657 CG42305-RA 92..235 9..152 720 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 23:38:05
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 18813296..18813397 51..152 510 100 Plus
2L 23513712 2L 18813100..18813143 9..52 220 100 Plus
Blast to na_te.dros performed on 2014-11-28 23:38:05 has no hits.

FMO09006.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-08-17 15:36:25 Download gff for FMO09006.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17325-RA 85..238 1..156 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:09:39 Download gff for FMO09006.5prime
Subject Subject Range Query Range Percent Splice Strand
CG42305-RB 86..239 1..156 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-29 00:09:24 Download gff for FMO09006.5prime
Subject Subject Range Query Range Percent Splice Strand
CG42305-RA 86..239 1..156 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-29 00:09:24 Download gff for FMO09006.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 18813094..18813143 1..52 92 -> Plus
2L 18813298..18813401 53..156 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:09:39 Download gff for FMO09006.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 18813094..18813143 1..52 92 -> Plus
arm_2L 18813298..18813401 53..156 98   Plus