Clone FMO09010 Report

Search the DGRC for FMO09010

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:90
Well:10
Vector:pMK33-CFH-BD
Associated Gene/TranscriptSfp87B-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO09010.5prime Sequence

287 bp (143 high quality bases) assembled on 2010-08-09

> FMO09010.5prime
CAATCGACATGCGTTTCGTATTTGTATTCGTCCTGTTATCGGTCCTGGCT
CTCAGTCTGGTTTCCGCCAAGGAACAATCAAAAACTAGCTCATCGCCAGG
AAGGAACAATGTCGGAGCCACAGAAAACCCTCGATTGCGTCCCAAGCGTA
ATATATTGTTCAATAGGCCCACCATTCGTGGTCAGGTGCAACGCTATATC
TATGGTTATCCCTATCATAATGGGGTTCCTACGTACTACAAATACCCGTA
CTACGGCTACTTCAAGATCGCAAACTTTCTAGACCAT

FMO09010.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:35:23
Subject Length Description Subject Range Query Range Score Percent Strand
Sfp87B-RA 396 CG42485-RA 55..315 9..269 1260 98.9 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 23:35:21
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 12273180..12273440 9..269 1260 98.9 Plus
Blast to na_te.dros performed on 2014-11-28 23:35:22 has no hits.

FMO09010.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-08-17 15:36:30 Download gff for FMO09010.5prime
Subject Subject Range Query Range Percent Splice Strand
Sfp87B-RA 46..323 1..278 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:07:45 Download gff for FMO09010.5prime
Subject Subject Range Query Range Percent Splice Strand
Sfp87B-RA 46..323 1..278 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-29 00:07:05 Download gff for FMO09010.5prime
Subject Subject Range Query Range Percent Splice Strand
Sfp87B-RA 46..323 1..278 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-29 00:07:05 Download gff for FMO09010.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 12273171..12273448 1..278 96   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:07:45 Download gff for FMO09010.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 8098893..8099170 1..278 96   Plus