Clone FMO09040 Report

Search the DGRC for FMO09040

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:90
Well:40
Vector:pMK33-CFH-BD
Associated Gene/Transcriptcer-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO09040.5prime Sequence

263 bp (263 high quality bases) assembled on 2010-08-09

> FMO09040.5prime
CAGTCGACATGTCCCTGGTTTCAGATGAGGAGTGGGTGGAGTACAAGTCC
AAGTTCGACAAGAACTACGAGGCAGAGGAGGATCTGATGCGTCGTAGAAT
CTACGCCGAGTCCAAAGCCCGGATTGAGGAACACAATCGGAAGTTCGAGA
AGGGCGAAGTGACTTGGAAAATGGGAATTAATCATTTGGCTGATCTCACG
CCTGAGGAATTTGCCCAGCGTTGTGGCAAAAAGGTGCCGCCAAATGCAAG
CTTTCTAGACCAT

FMO09040.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:35:17
Subject Length Description Subject Range Query Range Score Percent Strand
cer-RA 497 CG10460-RA 111..347 9..245 1185 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 23:35:16
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 19396365..19396564 245..46 1000 100 Minus
2R 25286936 2R 19396624..19396662 47..9 195 100 Minus
Blast to na_te.dros performed on 2014-11-28 23:35:16 has no hits.

FMO09040.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-08-17 15:36:13 Download gff for FMO09040.5prime
Subject Subject Range Query Range Percent Splice Strand
cer-RA 91..338 1..249 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:07:40 Download gff for FMO09040.5prime
Subject Subject Range Query Range Percent Splice Strand
cer-RA 103..350 1..249 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-29 00:07:03 Download gff for FMO09040.5prime
Subject Subject Range Query Range Percent Splice Strand
cer-RA 103..350 1..249 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-29 00:07:03 Download gff for FMO09040.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 19396362..19396562 48..249 99 <- Minus
2R 19396624..19396668 1..47 91   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:07:40 Download gff for FMO09040.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 15283867..15284067 48..249 99 <- Minus
arm_2R 15284129..15284173 1..47 91   Minus