Clone FMO09587 Report

Search the DGRC for FMO09587

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:95
Well:87
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCecA1-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO09587.5prime Sequence

215 bp (215 high quality bases) assembled on 2010-10-13

> FMO09587.5prime
CAGTCGACATGAACTTCTACAACATCTTCGTTTTCGTCGCTCTCATTCTG
GCCATCACCATTGGACAATCGGAAGCTGGTTGGCTAAAGAAAATTGGCAA
GAAAATCGAACGTGTTGGTCAGCACACTCGCGACGCCACAATCCAGGGAC
TGGGAATCGCTCAACAGGCCGCCAATGTTGCAGCCACTGCTCGAGGTGCA
AGCTTTCTAGACCAT

FMO09587.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 14:50:05
Subject Length Description Subject Range Query Range Score Percent Strand
CecA2-RA 355 CG1367-RA 82..271 8..197 950 100 Plus
CecA1-RA 339 CG1365-RA 74..263 8..197 800 94.7 Plus
CecC-RA 386 CG1373-RA 93..272 8..187 570 87.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 14:50:03
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 30212237..30212337 8..108 505 100 Plus
3R 32079331 3R 30210947..30211047 8..108 475 98 Plus
3R 32079331 3R 30212395..30212484 108..197 450 100 Plus
3R 32079331 3R 30216576..30216676 8..108 385 92.1 Plus
3R 32079331 3R 30211108..30211197 108..197 330 91.1 Plus
3R 32079331 3R 30213479..30213568 197..108 255 85.6 Minus
3R 32079331 3R 30216752..30216824 115..187 200 84.9 Plus
3R 32079331 3R 30213626..30213730 108..4 195 79 Minus
Blast to na_te.dros performed on 2014-11-26 14:50:04 has no hits.

FMO09587.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:01:15 Download gff for FMO09587.5prime
Subject Subject Range Query Range Percent Splice Strand
CecA2-RA 79..274 1..201 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:44:46 Download gff for FMO09587.5prime
Subject Subject Range Query Range Percent Splice Strand
CecA2-RA 79..274 1..201 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:41:45 Download gff for FMO09587.5prime
Subject Subject Range Query Range Percent Splice Strand
CecA2-RA 79..274 1..201 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:41:45 Download gff for FMO09587.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 30212234..30212336 1..107 96 -> Plus
3R 30212395..30212487 108..201 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:44:46 Download gff for FMO09587.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 26037956..26038058 1..107 96 -> Plus
arm_3R 26038117..26038209 108..201 97   Plus