Clone FMO09590 Report

Search the DGRC for FMO09590

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:95
Well:90
Vector:pMK33-CFH-BD
Associated Gene/TranscriptMet75Ca-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO09590.5prime Sequence

179 bp (179 high quality bases) assembled on 2010-10-13

> FMO09590.5prime
CAGTCGACATGAACGTATTCAATGGTTTCTTGCTAGTCTTCCTGGGCCTG
GCCCTCAGCTCTGTGGATGCACAGATAGCAACACGCCAGGAAACCTCGGA
GGACAAGGCTTGTGGTCCCCACGCCTACTACAATTACGCCCGGCACACTT
GCCTGCCATTCGCAAGCTTTCTAGACCAT

FMO09590.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 14:50:17
Subject Length Description Subject Range Query Range Score Percent Strand
Met75Ca-RA 242 CG32197-RA 21..173 9..161 765 100 Plus
Met75Cb-RA 241 CG18064-RA 21..173 9..161 765 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 14:50:15
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 18469446..18469598 161..9 765 100 Minus
3L 28110227 3L 18472212..18472364 161..9 765 100 Minus
Blast to na_te.dros performed on 2014-11-26 14:50:16 has no hits.

FMO09590.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:01:17 Download gff for FMO09590.5prime
Subject Subject Range Query Range Percent Splice Strand
Met75Ca-RA 1..156 9..162 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:44:51 Download gff for FMO09590.5prime
Subject Subject Range Query Range Percent Splice Strand
Met75Ca-RA 14..185 1..171 95   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:41:50 Download gff for FMO09590.5prime
Subject Subject Range Query Range Percent Splice Strand
Met75Cb-RA 14..185 1..171 95   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:41:50 Download gff for FMO09590.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 18469434..18469605 1..171 95   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:44:51 Download gff for FMO09590.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 18462534..18462705 1..171 95   Minus