Clone FMO09593 Report

Search the DGRC for FMO09593

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:95
Well:93
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG15458-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO09593.5prime Sequence

215 bp (215 high quality bases) assembled on 2010-10-13

> FMO09593.5prime
CAGTCGACATGTCCGATCATTTCAACTTCAACGAAGCCTTCAACAGCCAG
ACCATGCGTGGTCGCGCCAATGTAGCCAAGGCCACCTGGGCCTCGTTGGG
ACTCGTCTACGTCCTGGTCAAGATGCACCGCCGCAACACGAAGCGGCGCG
AGACCAAGCTCTACTGCAAGGGCTGCCAGCAGGCCATGCTCCATGGCGCA
AGCTTTCTAGACCAT

FMO09593.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 14:50:28
Subject Length Description Subject Range Query Range Score Percent Strand
CG15458-RA 486 CG15458-RA 113..301 9..197 945 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 14:50:25
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 20413837..20413962 197..72 630 100 Minus
X 23542271 X 20414022..20414087 74..9 330 100 Minus
Blast to na_te.dros performed on 2014-11-26 14:50:27 has no hits.

FMO09593.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:01:19 Download gff for FMO09593.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15458-RA 1..192 9..198 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:44:56 Download gff for FMO09593.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15458-RA 113..301 9..197 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:41:55 Download gff for FMO09593.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15458-RA 113..301 9..197 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:41:55 Download gff for FMO09593.5prime
Subject Subject Range Query Range Percent Splice Strand
X 20413837..20413962 72..197 100 <- Minus
X 20414025..20414087 9..71 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:44:56 Download gff for FMO09593.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 20284864..20284989 72..197 100 <- Minus
arm_X 20285052..20285114 9..71 100   Minus