Clone FMO09596 Report

Search the DGRC for FMO09596

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:95
Well:96
Vector:pMK33-CFH-BD
Associated Gene/Transcriptox-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO09596.5prime Sequence

191 bp (191 high quality bases) assembled on 2010-10-13

> FMO09596.5prime
CAGTCGACATGAAGGTTATCTACAACACCCTGTTCAAGCGCACCTCCACC
TACGCCGTGGCCATCATCGCGTCGGCCTTTTTCTTCGAGCGCGCTCTCGA
TGTCACGTCGGTTGCGATTTTCGAGGGCATCAACAAAGGCAAACTCTGGA
AGGACATCAAGGGCAAATACGAAGCAAGCTTTCTAGACCAT

FMO09596.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 14:49:55
Subject Length Description Subject Range Query Range Score Percent Strand
ox-RA 331 CG8764-RA 99..265 7..173 835 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 14:49:53
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 12757298..12757431 140..7 670 100 Minus
Blast to na_te.dros performed on 2014-11-26 14:49:54 has no hits.

FMO09596.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:01:13 Download gff for FMO09596.5prime
Subject Subject Range Query Range Percent Splice Strand
ox-RA 86..265 1..181 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:44:39 Download gff for FMO09596.5prime
Subject Subject Range Query Range Percent Splice Strand
ox-RA 92..271 1..181 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:41:39 Download gff for FMO09596.5prime
Subject Subject Range Query Range Percent Splice Strand
ox-RA 92..271 1..181 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:41:39 Download gff for FMO09596.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 12757298..12757436 1..140 97   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:44:39 Download gff for FMO09596.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 8644803..8644941 1..140 97   Minus