Clone FMO09635 Report

Search the DGRC for FMO09635

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:96
Well:35
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG1999-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO09635.5prime Sequence

656 bp (656 high quality bases) assembled on 2010-11-05

> FMO09635.5prime
CAGTCGACATGCAGCGTTCGTCTTATCCTCTATGCCACATTGTGCGACCC
AGCTTGACTGGGCTTTTAGGCGGCGGATGGATTGACCTTCGAAGGACTAT
GGCCTCAGATTCGTGGGGACGGGGTGACGGCAATAGCCAGCCCAATTCGC
CAAGGGCTGGCGTTTCGCGTGCCAGTGCCACATCGACGGTGATAAGTGAT
GCCAGCTCCTATTCGCGTGGCGTCAACACTGGTGCTTTCGAGCGACGCAT
CAATCGGGAGGATAATATGTGGAGGGATCAGAGCTATATCGATACAAAAT
GGTTAAATCCTCGCGATCCCAATGCCTATCGACCGAATTTCCGTCAAACA
GAGCCGACATCGTTGCGCAAGCAATTCATGCGCAGTCCGGATGAAATATC
CCGTGAGGTGATGGGTCGTGATTGGGAGGAAACGGTCAGGACATATAAAC
GCAACGCCCAGAGCAAACACAGTGTGGCGCGCACAGAGGAGCGGCAATCT
TCGGATAATACACGTAATCGCCAGCAACATTTGCAATTAATGCACATGCA
ACAGCAACAAAGGCAACAGCAGCAACATAAGAAAAATCAGCAGCAGTACA
ACAATTGGGGCAGGAGTGTGGAGTCCCCCGAGGATCAAGCAAGCTTTCTA
GACCAT

FMO09635.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:49:38
Subject Length Description Subject Range Query Range Score Percent Strand
CG1999-RA 1091 CG1999-RA 164..794 8..638 3155 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:49:34
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 7359131..7359761 8..638 3155 100 Plus
Blast to na_te.dros performed 2014-11-26 16:49:36
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6758..6856 522..616 180 69.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6737..6838 522..616 178 68.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6791..6873 522..603 178 69.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2290..2471 413..604 171 58.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1533..1616 522..606 170 68.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2243..2387 459..604 168 60.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2352..2441 522..613 167 66.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6727..6807 533..615 167 70.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6803..6888 522..603 167 70.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2765..2837 521..596 166 71.1 Plus
roo 9092 roo DM_ROO 9092bp 1073..1153 522..604 158 69 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6710..6786 540..615 157 68.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2297..2356 539..598 156 73.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6731..6823 522..616 155 64.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2581..2656 534..612 154 71.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2367..2462 522..616 153 63.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2580..2681 501..605 150 64.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2415..2492 522..604 142 67.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2429..2516 512..604 138 66 Plus
roo 9092 roo DM_ROO 9092bp 1061..1116 549..603 133 73.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2805..2872 549..618 129 67.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2325..2401 522..603 128 65.9 Plus
roo 9092 roo DM_ROO 9092bp 1097..1181 522..606 128 65.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1524..1593 534..604 127 66.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6827..6947 522..642 127 58.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1516..1583 547..616 120 65.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6858..6922 517..581 118 64.6 Plus
roo 9092 roo DM_ROO 9092bp 1046..1162 484..596 116 58.1 Plus
Dvir\Het-A 6610 Dvir\Het-A HETAVIR 6610bp 3279..3341 552..613 114 66.7 Plus

FMO09635.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:17 Download gff for FMO09635.5prime
Subject Subject Range Query Range Percent Splice Strand
CG1999-RA 164..797 8..642 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:07:23 Download gff for FMO09635.5prime
Subject Subject Range Query Range Percent Splice Strand
CG1999-RA 164..797 8..642 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:37:47 Download gff for FMO09635.5prime
Subject Subject Range Query Range Percent Splice Strand
CG1999-RA 164..797 8..642 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:37:47 Download gff for FMO09635.5prime
Subject Subject Range Query Range Percent Splice Strand
X 7359125..7359764 1..642 99   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:07:23 Download gff for FMO09635.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 7253158..7253797 1..642 99   Plus