Clone FMO10052 Report

Search the DGRC for FMO10052

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:52
Vector:pMK33-CFH-BD
Associated Gene/Transcript
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10052.5prime Sequence

263 bp (263 high quality bases) assembled on 2010-10-30

> FMO10052.5prime
CAGTCGACATGGTAACACGAATTGATACTGCGTTGATTTGGATCGTTGAA
CACAGTTACATACGTTACATTTTGCACGTTTTCTATTGCGATTTACAATT
AGTTTTGCCAGTTCACACAATCTCCTTTGATTATTGTAAGCCAATTAATA
CTACTTACAGTGACAATACTAAAATACAGCTGTGTATGAAAGTGGACAAT
ACACAAAACCATACACTACAACTAAAACAAAAACAAATCAGAATTGCAAG
CTTTCTAGACCAT

FMO10052.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed on 2014-11-26 15:12:56 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:12:54
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 10204928..10205164 9..245 1185 100 Plus
X 23542271 X 9557669..9557793 197..76 290 84 Minus
Blast to na_te.dros performed 2014-11-26 15:12:55
Subject Length Description Subject Range Query Range Score Percent Strand
HeT-A 6083 HeT-A DM06920 6083bp Derived from U06920.2 (Rel. 67, Last updated, Version 14). 5113..5232 130..249 113 58.2 Plus

FMO10052.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:46 Download gff for FMO10052.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32690-RA 422..665 1..248 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:52:15 Download gff for FMO10052.5prime
Subject Subject Range Query Range Percent Splice Strand
X 10204924..10205170 1..250 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:52:15 Download gff for FMO10052.5prime
Subject Subject Range Query Range Percent Splice Strand
X 10204924..10205170 1..250 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:56:11 Download gff for FMO10052.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 10098957..10099203 1..250 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:56:11 Download gff for FMO10052.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 10098957..10099203 1..250 97   Plus