FMO10087.5prime Sequence
257 bp (257 high quality bases) assembled on 2010-10-30
> FMO10087.5prime
CAGTCGACATGTGGAGTAGTACTATATCGCCAACCAACTCTAAGAAACTG
TTGATCGGAAGCACACGAAGCGTTGATTATGTCGGTGATAGTGCGAGGAC
AGCAGCAGGCAATATCAAAACAGGAGCAGCAGCAGCCGCAGGAGCCAAAG
GATCAAAATCCAAAGCCACAGCCACAGCCCCCACAACCAAGATCTCAATC
GAAATGGAGCTCCACATACAGAACAAGTGCATCTCGGCAGCAAGCTTTCT
AGACCAT
FMO10087.5prime Blast Records
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:13:52
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| CG14669-RB | 4442 | CG14669-RB | 744..974 | 9..239 | 1155 | 100 | Plus |
| CG14669-RD | 3648 | CG14669-RD | 744..974 | 9..239 | 1155 | 100 | Plus |
| CG14669-RA | 3648 | CG14669-RA | 744..974 | 9..239 | 1155 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:13:49
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| 3R | 32079331 | 3R | 5437314..5437544 | 9..239 | 1155 | 100 | Plus |
Blast to na_te.dros performed 2014-11-26 15:13:50
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2324..2468 | 99..243 | 192 | 62.6 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6808..6942 | 99..242 | 148 | 61.1 | Plus |
| roo | 9092 | roo DM_ROO 9092bp | 1059..1150 | 101..189 | 127 | 65.6 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2606..2677 | 99..170 | 108 | 64.9 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 6820..6900 | 99..176 | 108 | 65.9 | Plus |
| Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2443..2519 | 113..189 | 106 | 59.7 | Plus |
FMO10087.5prime Sim4 Records
Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:54 Download gff for
FMO10087.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG14669-RA | 473..714 | 1..245 | 97 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:56:33 Download gff for
FMO10087.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG14669-RC | 737..978 | 1..245 | 97 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:52:37 Download gff for
FMO10087.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG14669-RA | 737..978 | 1..245 | 97 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:52:37 Download gff for
FMO10087.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| 3R | 5437307..5437548 | 1..245 | 97 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:56:33 Download gff for
FMO10087.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| arm_3R | 1263029..1263270 | 1..245 | 97 | | Plus |
